zum Directory-modus

Übung

Als interner Standard für die Real-time PCR wird oft ein ribosomales Gen verwendet, dessen Expression mehr oder weniger immer unverändert hoch ist - das L27-Gen, das für ein Protein der 60S-Untereinheit des Ribosoms codiert.

Aufgabe

Bitte berechnen Sie die Schmelztemperatur des ersten Primers.

Fw-Primer AAAGCCGTCATCGTGAAGAAC: °C

ZurücksetzenAuswertenLösung zeigen
Aufgabe

Bitte berechnen Sie die Schmelztemperatur des zweiten Primers.

Rv-Primer GCTGTCACTTTCCGGGGATAG: °C

ZurücksetzenAuswertenLösung zeigen
Hinweis
Zur Erinnerung: Die Formel lautet Schmelztemperatur in °C   =   (A + T) · 2   +   (G + C) · 4